View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20082_low_38 (Length: 222)
Name: NF20082_low_38
Description: NF20082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20082_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 209
Target Start/End: Complemental strand, 8420893 - 8420704
Alignment:
| Q |
21 |
aattcttttttgctgttaataaacggatgcaatagaaagagtacatgacaacaataaggacacgaac-acccctgttattatcaatttctataagcaata |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
8420893 |
aattcttttttgttgttaataaacggatgcaatagaaagactacatgacaacaataaggacactaaccacccatgttattatcaatttcaataagcaata |
8420794 |
T |
|
| Q |
120 |
ttagactgtaatgcattagcacaactatttgcttctctacggatatgatatgactcacttcagtcttctacccatgttgatgaagaatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8420793 |
ttagactgtaatgcattagcacaactatttgcttctctacggatatgatatgactcacttcagtcttctacccatgttgatgaagaatat |
8420704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University