View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_26 (Length: 311)
Name: NF20083_high_26
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 14 - 295
Target Start/End: Complemental strand, 44034358 - 44034077
Alignment:
| Q |
14 |
tacttatgtcaaaaaagttaacatttcatagccnnnnnnnngtttcttcttccatattttacagcttaagacatcctttcattgtttactgtttgtgtta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44034358 |
tacttatgtcaaaaaagttaacatttcatagccttttttttgtttcttcttccatattttacagcttaagacatcctttcattgtttactttttgtgtta |
44034259 |
T |
 |
| Q |
114 |
gtgttcttgtttgtttgtcttttgatactctgaaggatgctacgtgtgttcaactttttgttcacatcggtgcttctgttatcctaattgannnnnnnac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44034258 |
gtgttcttgtttgtttgtcttttgatactctgaaggatgctacgtgtgttcaactttttgttcacatcggtgcttctgttatcctaattgatttttttac |
44034159 |
T |
 |
| Q |
214 |
attggatgcatcttttcttacgaagtctatgtttttgttgaaatttagtgtaaatttgccaataaactaacagtctattatg |
295 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44034158 |
attggatgcatcttttcttaccaagtctatgtttttgtcgaaattcagtgtaaatttgccaataaactaacagtctattatg |
44034077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University