View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_32 (Length: 265)
Name: NF20083_high_32
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 21790385 - 21790156
Alignment:
| Q |
20 |
gacgacgacaacgccaaaatacnnnnnnnctcagatctgcgtcaatagttccaacttttgtcaccaccatcaccaaaatcaagagaccgcataaaaagca |
119 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||| || |
|
|
| T |
21790385 |
gacgacgacaacgccgaaatacaaaaaaactcagatctgcgtcaacagttccaacttttgtcaccaccatcaccaaaatccatagaccgcataaaaaaca |
21790286 |
T |
 |
| Q |
120 |
caacaaccttgcattttagttcattttttattactgatctgcgttttgagatctactatgatagagaagaaagggagacggcgatgagagagactgagat |
219 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
21790285 |
caacaaccttgtattttggttcattttttattactgatctgcgtttttagatctactgtgatagagaagaaagggaggcggcggtgagagagactgagat |
21790186 |
T |
 |
| Q |
220 |
aaagatgtccgacgatgctgaggctgaggg |
249 |
Q |
| |
|
||||||||||||||||| || ||| ||||| |
|
|
| T |
21790185 |
aaagatgtccgacgatgttggggcggaggg |
21790156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 49 - 249
Target Start/End: Complemental strand, 21792879 - 21792677
Alignment:
| Q |
49 |
ctcagatctgcgtcaatagttccaacttttgtcaccaccatcaccaaaatcaagagaccgcataaaaagcacaacaaccttgcattttagttcatttttt |
148 |
Q |
| |
|
||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| || |||||| |
|
|
| T |
21792879 |
ctcagatatgcgccaatagttccaaattttgtcaccaccatcaccaaaatcaagagactgcataaaacacacaacaaccttgcattttgatttgtttttt |
21792780 |
T |
 |
| Q |
149 |
attactgatctgcgttttgagatctactatgatagagaagaaaggga---gacggcgatgagagagactgagataaagatgtccgacgatgctgaggctg |
245 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||| |||||| ||||||| | |||||||||||||||||| ||||||||||||||||| ||||||||| | |
|
|
| T |
21792779 |
-ttactggtctgcgttttcagatctactgtgaaagagaaaaaagggaggcggcggcgatgagagagactgcgataaagatgtccgacggtgctgaggcgg |
21792681 |
T |
 |
| Q |
246 |
aggg |
249 |
Q |
| |
|
|||| |
|
|
| T |
21792680 |
aggg |
21792677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 3272414 - 3272460
Alignment:
| Q |
51 |
cagatctgcgtcaatagttccaacttttgtcaccaccatcaccaaaa |
97 |
Q |
| |
|
||||||||| |||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
3272414 |
cagatctgcatcaacagttccaccttatgtcaccaccatcaccaaaa |
3272460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University