View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_40 (Length: 243)
Name: NF20083_high_40
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_40 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 36167867 - 36168109
Alignment:
| Q |
1 |
cttaagtttggttagatatccgactctcgtaaactctcactaacttgaacgttgaagttcttacatgtaaattctttggagaataacgatgtccacattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
36167867 |
cttaagtttggttagatatccgactctcgtaaactctcactaatttgaacgttgaagttcttacatgtaaattctctggagaataacgatgtccgcattc |
36167966 |
T |
|
| Q |
101 |
aaccaaccttcttctatcgtcgtattcaggttaactcttgatcacttggaatactcaaattatacactattcttttagatttgaaccatagattttttct |
200 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
36167967 |
aaccaaccttcttcgatcgtcatattcaggttaaatcttgatcatttggaatactcaaattatatactattcttttagatttgaaccatggattttttct |
36168066 |
T |
|
| Q |
201 |
tcgatatataaatgcaagatacacactttcttgagaataatct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
36168067 |
tcgatatataaatgcaagatacacactttcttaagaattatct |
36168109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University