View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_43 (Length: 240)
Name: NF20083_high_43
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 24 - 231
Target Start/End: Complemental strand, 1753430 - 1753228
Alignment:
| Q |
24 |
agttaattttctacatgaatgaaaagaaaagtataattattctttagagaaatgaagttgcaatgaagataacccggtggtaccagggttgttaagctga |
123 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753430 |
agttaattttctacatggat-----gaaaagtataattaatctttagggaaatgaagttgcaatgaagataacccggtggtaccagggttgttaagctga |
1753336 |
T |
 |
| Q |
124 |
tgaagctgtttatgaccacggcgaagtaaatattcaatgtattgaaaattcttcctatcaacttgttttgaattgtgacgaaattcttgagatactatgg |
223 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753335 |
tcaagctgtttatgaccacggcgaagtaaatattcaatgtattgaaaattcttcctatcaacttcttttgaattgtgacgaaattcttgagatactatgg |
1753236 |
T |
 |
| Q |
224 |
atcctatg |
231 |
Q |
| |
|
|| ||||| |
|
|
| T |
1753235 |
attctatg |
1753228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University