View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20083_high_50 (Length: 216)

Name: NF20083_high_50
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20083_high_50
NF20083_high_50
[»] chr5 (1 HSPs)
chr5 (16-198)||(26614233-26614415)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 26614233 - 26614415
Alignment:
16 atgaaatgataaagtatattttggtggtttgtaatgtaatgctgcagggaggggtacatatcaaggtgggggtgtggggacaggagcagcagcggcgtac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26614233 atgaaatgataaagtatattttggtggtttgtaatgtaatgctgcagggaggggtacatatcaaggtgggggtgtggggacaggagcagcagcggcgtac 26614332  T
116 ggcggtgttccggcaggagggccaccacaaatggcagcaggagcagcaacagctccagtaatgtaccaaccatatgggtatgt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26614333 ggcggtgttccggcaggagggccaccacaaatggcagcaggagcagcaacagctccagtaatgtaccaaccatatgggtatgt 26614415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University