View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_51 (Length: 207)
Name: NF20083_high_51
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 4965406 - 4965228
Alignment:
| Q |
15 |
cataggttatgtaaaagcaagaagatgttaagaaaagttgtgaaggtttatagcacatattttctatctggaagttgttttcattcttaactttgggtga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4965406 |
cataggttatgtaaaagcaagaagatgttaagaaaagttgtaaaggtttatagcacgtatttgctatctggaagttgttttcattcttaactttgggtga |
4965307 |
T |
 |
| Q |
115 |
gtaatgtgatttttatattgtgttgttgtcaatgtgttgtttaacctaaggtactaaggttactatccatgaggttact |
193 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
4965306 |
gtaatgtgatttttatattgtgttgctatcaatgtgttgtttaacctaagctactaatgttactatccacaaggttact |
4965228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University