View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_high_9 (Length: 539)
Name: NF20083_high_9
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 463; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 20 - 517
Target Start/End: Original strand, 32726080 - 32726586
Alignment:
| Q |
20 |
gcccattggaccccttccatgatatcgtagtcgatgacatggacgcggcgttcgtgggccacggcttcgatgatggcttgattggctgtgaagtggccga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726080 |
gcccattggaccccttccatgatatcgtagtcgatgacatggacgcggcgttcgtgggccacggcttcgatgatggcttgattggctgtgaagtggccga |
32726179 |
T |
|
| Q |
120 |
atttgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgcggggaccatttgtggtgaggtaatgtttgttgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32726180 |
atttgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgtggggaccatttgtggtgaggtaatgtttgttgtt |
32726279 |
T |
|
| Q |
220 |
gttgtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggcaagtctctccatgttggagccg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726280 |
gttgtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggcaagtctctccatgttggagccg |
32726379 |
T |
|
| Q |
320 |
ttagcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatca |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726380 |
ttagcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatca |
32726479 |
T |
|
| Q |
420 |
ataggtgcactagttttagcccttttgaatcatcaccaacttcttgcgtttttattgtcgttgtt---------gttgttgtttccatttcttcttcttc |
510 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
32726480 |
ataggtgcactagttttagcccttttgaatcatcaccaacttcatgcgtttttattgccgttgttgttgttgtggttgttgtttccatttcttcttcttc |
32726579 |
T |
|
| Q |
511 |
ctcatcc |
517 |
Q |
| |
|
||||||| |
|
|
| T |
32726580 |
ctcatcc |
32726586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University