View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_low_32 (Length: 280)
Name: NF20083_low_32
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_low_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 13 - 280
Target Start/End: Complemental strand, 52477178 - 52476911
Alignment:
| Q |
13 |
catcatattagtctttgagctatcacataaataaaattggacataacatcttcaccccaaaactttaagacatgcgggttcttgatgacaatttatagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477178 |
catcatattagtctttgagctatcacataaatgaaattggacataacatcttcaccccaaaactttaagacatgcgggttcttgatgacaatttatagtt |
52477079 |
T |
 |
| Q |
113 |
atagtgaaaataacagtaacaaagaggaacttagaatttgagactcttaagagaggactaagttgtgtatgcattgcagatatggattttgcttcaagac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52477078 |
atagtgaaaataacagtaacaaagaggaacttagaatttgagactcttaagagaggactaagttgtgtatgcattgcagatatggaaattgcttcaagac |
52476979 |
T |
 |
| Q |
213 |
caagttgtttggggaaacccatgttttcatttcgagcaaggagtcagcaaaggtgattctaagaaacg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476978 |
caagttgtttggggaaacccatgttttcatttcgagcaaggagtcagcaaaggtgattctaagaaacg |
52476911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University