View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_low_36 (Length: 264)
Name: NF20083_low_36
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_low_36 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 36167700 - 36167437
Alignment:
| Q |
1 |
ttttgcatgtaaaactaatgaaaaatattttatcattttcgttttagaccttacccttgagccaaccctgatttgggggctccaacgtttaagtttgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
36167700 |
ttttgcatgtaaaactaatgaaaaatattttatcattttcgttttaggccttgcccttaagccaaccctaatttgggggctccaacgcttaagttagtga |
36167601 |
T |
|
| Q |
101 |
gaattttatgagatctagagagcatggtgttgattcacatatcatcgtctaattatcattatagggtcattaagtaatggatcatgagggatgattcatg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36167600 |
gaattttatgagacctagagagcatggtgttaattcacatatcatcgtctaattatcattatagggtcattaattaatggatcatgagggatgattcatg |
36167501 |
T |
|
| Q |
201 |
gtgttgtcttgttggactgtggattcttcacgaattagatcataggtagtccaaaataaaggat |
264 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36167500 |
gtgttgtattgttggactgtggatccttcacgaattagatcttaggtagtccaaaataaaggat |
36167437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University