View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20083_low_53 (Length: 216)
Name: NF20083_low_53
Description: NF20083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20083_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 26614233 - 26614415
Alignment:
| Q |
16 |
atgaaatgataaagtatattttggtggtttgtaatgtaatgctgcagggaggggtacatatcaaggtgggggtgtggggacaggagcagcagcggcgtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26614233 |
atgaaatgataaagtatattttggtggtttgtaatgtaatgctgcagggaggggtacatatcaaggtgggggtgtggggacaggagcagcagcggcgtac |
26614332 |
T |
|
| Q |
116 |
ggcggtgttccggcaggagggccaccacaaatggcagcaggagcagcaacagctccagtaatgtaccaaccatatgggtatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26614333 |
ggcggtgttccggcaggagggccaccacaaatggcagcaggagcagcaacagctccagtaatgtaccaaccatatgggtatgt |
26614415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University