View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_high_16 (Length: 273)
Name: NF20084_high_16
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 13031549 - 13031794
Alignment:
| Q |
17 |
actgtttggcttaaatggtattattgttcaataatatttttctttatggcnnnnnnnnngaaagataggaggaactgtttggctgagacattgacacaaa |
116 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13031549 |
actgcttggcttaaatggtatgattgttcaataatatttttctttatggcaaaaaaaaa-aaagataggaggaactgtttggctgagacattgacacaaa |
13031647 |
T |
|
| Q |
117 |
attataaagaaaagaaactctatacgcaactaggaatgtgaaacaattcaggaatggagcaaatagaagttctgaacataatcataattcatatccttag |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13031648 |
attataaagaaaagaaactctagacgcaactaggaatgtgaaacaattcaggaatgcagcaaatagaagttctgaacataatcataattcatatccttag |
13031747 |
T |
|
| Q |
217 |
tagtcctcaaaaaccaaatggaatttgtaaacatggtcataattcat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13031748 |
tagtcctcaaaaaccaaatggaatttgtaaacatggtcataattcat |
13031794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University