View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_high_17 (Length: 258)
Name: NF20084_high_17
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 13031967 - 13032209
Alignment:
| Q |
1 |
gtttttattgcacttgttttgtattttttcagcttcttagatactttatctatgtgcttcacttgttctaatttgtatttctatctatttattctccann |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13031967 |
gttttcattgcacttgttttgtattttttcagcttcttagatactttatctatgtgcttcacttgttctaatttgtatttctatctatttattctccatt |
13032066 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnncaaatttgaacctttatgtagagaatgtttcaaatacaacaagttaacaatgttgacgaatgatgactctatgattcattactctt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13032067 |
ttgttttcttttttcaaatctgaacctttatgtagagaatgtttcaaatacaacaagttaacaatgt----------tgactctatgattcattactctt |
13032156 |
T |
|
| Q |
201 |
cgtacttttaaaagtgtaatcagggaataaaactattgtcctttccctttgct |
253 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
13032157 |
catacttttaaaagtgtaattagggaataaaactattgtcctttccttttgct |
13032209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University