View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_high_20 (Length: 235)
Name: NF20084_high_20
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_high_20 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 82766 - 82986
Alignment:
| Q |
1 |
taaatggtcaatttgatttgaaaaacacaaggaacaaatatgtttcaaatgtt-aaacttaacatagcggatgatgcaagttacaagttttaacgatttg |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
82766 |
taaatggtcaatttgatttaaaaaacacaaggaacaaatatgtttcaaatgtttaaacttaacatagcggatgatggaagttacaagttttaacgatttc |
82865 |
T |
 |
| Q |
100 |
tgaaacaaaacttgtacacaaaatcttgcatgataaagaggttaactttatgacattaccatatccatggcgaccacaagtcgccagagcaagctttctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82866 |
tgaaacaaaacttgtacacaaaatcttgcatgataaagaggttaactttatgacattaccatatccatggcgaccacaagtcgccagagcaagctttctg |
82965 |
T |
 |
| Q |
200 |
ctggaagaaagaggacgaaaa |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
82966 |
ctggaagaaagaggacgaaaa |
82986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University