View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_low_13 (Length: 298)
Name: NF20084_low_13
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 265
Target Start/End: Original strand, 37204107 - 37204361
Alignment:
| Q |
12 |
atgaatgctattgaattggtttttcagaaagattggatggatgcatttatggattgagtctaattcacaactcattgttcaagcatacaagaattatagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204107 |
atgaatgctattgaattggtttttcagaaagattggatggatgcatttatggattgagtctaattcacaactcattgttcaagcatacaagaattatagc |
37204206 |
T |
|
| Q |
112 |
cgttgggttaatgcatccaacttagatatatgaacttta-nnnnnnnactctttaaagagggcgatcatttgtgctaatttaatggctctgctctaaaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37204207 |
cgttgggttaatgcatccaacttagatatatgaactttattttttttactctttaaagagggcgatcatttgtgctaacttaatggctctgctctaaaag |
37204306 |
T |
|
| Q |
211 |
tgcattttaatggtctccattcgtggaatcaagttactgctagtatctctggtga |
265 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
37204307 |
tgcattttaatggtctgcattggtggaatcaagtcactgctagtatctctggtga |
37204361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University