View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_low_18 (Length: 257)
Name: NF20084_low_18
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 7429288 - 7429526
Alignment:
| Q |
18 |
atactatggcatcctctgttgcctcgtctacatgtcattctcctttttaaccatgcaactaaaaagtagatgtttcaatttgtggaactaaaaatatgga |
117 |
Q |
| |
|
||||| |||||||||| ||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7429288 |
atactgtggcatcctccgttatctggtctacatgtcattctcctttttaaccatgcaactagaaagtagatgtttcaattcgtggaactaaaaatatgga |
7429387 |
T |
|
| Q |
118 |
atacaagt-cctaaagttgaattatcatttgtctttgatcgattctgactctcccacgacccttgtcagactctcagaacctg-gnnnnnnnnnttatgt |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||| |
|
|
| T |
7429388 |
atacaagtccctaaagttgaattatcatttgtctttgatcgattctgactctcccacgacccttgtcaaactctcagaacctgaaaaaaaaaaattgtgt |
7429487 |
T |
|
| Q |
216 |
agctcgtatttgattgtctataattcaattgatcattct |
254 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7429488 |
agctcatatttgattgtctataattcaattgatcattct |
7429526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University