View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_low_24 (Length: 216)
Name: NF20084_low_24
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 54609703 - 54609903
Alignment:
| Q |
1 |
tgaattaattatgattaccatacataatgtctttgagtttaaagtaataaatacttaattatctaccaagtc----ttatgttgtgtctataagaagtta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54609703 |
tgaattaattatgattaccatacataatgtctttgagtttaaagtaataaatac----ttatctaccaagtcctatatatgttgtgtctataagaagtta |
54609798 |
T |
 |
| Q |
97 |
cagaattctagtgctaatgctaacttatgttaaaaccnnnnnnngcctcagccacatcctcgttcatctcccttatctcaaaagttaaaacgggaaagaa |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
54609799 |
cagaattctagtgctaatcctaacttatgttaaaacctttttttgcctcagccacatcctcgttcgtctccctaatctcaaaagttaaaacgggaaagaa |
54609898 |
T |
 |
| Q |
197 |
gatag |
201 |
Q |
| |
|
||||| |
|
|
| T |
54609899 |
gatag |
54609903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University