View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20084_low_27 (Length: 207)
Name: NF20084_low_27
Description: NF20084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20084_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 40233310 - 40233138
Alignment:
| Q |
19 |
aactaagataagcacaaccacaaaaaagcgtgacagaaggtgagtgagacaagtcaatggtaccaaaatctgggagtgggcagatgacagcaagagttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40233310 |
aactaagataagcacaaccacaaaaaagcgtgacagaaggtgagtgagacaagtcaatggtaccaaaatctgggagtgggcagatgacagcaagagttta |
40233211 |
T |
|
| Q |
119 |
actnnnnnnngcttcattgttattactacaaaagctgtagactcattacaatcatcgaaagtttattccagaa |
191 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40233210 |
actaaaaaaagcttcattgttattactacaaaagctgtagactcattacaatcatcgaaagattattccagaa |
40233138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University