View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20087_high_5 (Length: 266)
Name: NF20087_high_5
Description: NF20087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20087_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 27700888 - 27700638
Alignment:
| Q |
1 |
tgttttcattatattgtttggcactggttttgatctgaattctttcttgtctcagaaggaaagaaagtggtcaattcaactcttggctttttgttgctta |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27700888 |
tgttttcattatgttgtttggcactggttttgatctgaattctttcttgtctcagaaggaaagaaagtggtcaattcaactcttggctttttgttgctta |
27700789 |
T |
|
| Q |
101 |
tatctggcagccaaaattgatgaggttgttgttcctcgatctgttgatatgcaggtatattatttttctttgatgcttacttgctagtttgaaaatgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27700788 |
tatctggcagccaaaattgatgaggttgttgttcctcgatctgttgatatgcaggtatattatttttctttcatgcttacttgctagtttgaaaatgttt |
27700689 |
T |
|
| Q |
201 |
tatatcacgatgtatgcagcaccaacactttaaatttaaggcgtgtctgat |
251 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27700688 |
tatatcgcgatgtatgcagcaccaacattttaaatttaaggcgtgtctgat |
27700638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University