View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20088_low_1 (Length: 413)
Name: NF20088_low_1
Description: NF20088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20088_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 248 - 400
Target Start/End: Original strand, 37494524 - 37494676
Alignment:
| Q |
248 |
tagctaagaattaattaatattgataatatgaatattaaccatatgattgagtaaaaaatatatcatatgatgaattgaaggaagtagaataataaataa |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494524 |
tagctaagaattaattaatattgataatattaatattaaccatatgattgagtaaaaaatatatcatatgatgaattgaaggaagtagaataataaataa |
37494623 |
T |
|
| Q |
348 |
ccttttggcattctaaaaaagcagatagtagatttggataaagagggtgagtt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494624 |
ccttttggcattctaaaaaagcagatagtagatttggataaagagggtgagtt |
37494676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 15 - 144
Target Start/End: Original strand, 37494291 - 37494420
Alignment:
| Q |
15 |
aaaatataccatgaagtggtcaaggtcaggatcatctcctatctcacggaaagcattattttggtggctttcacgccctatttcttcaagaagagacgca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494291 |
aaaatataccatgaagtggtcaaggtcaggatcatctcctatctcacggaaagcattatttgggtggctttcacgccctatttcttcaagaagagacgca |
37494390 |
T |
|
| Q |
115 |
agttctgttggtgccccaaccttcatacac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37494391 |
agttctgttggtgccccaaccttcatacac |
37494420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University