View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20089_high_3 (Length: 351)
Name: NF20089_high_3
Description: NF20089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20089_high_3 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 24 - 138
Target Start/End: Original strand, 14510075 - 14510189
Alignment:
| Q |
24 |
tggtcatattttgcatgcaaattgtcaatatgaagaggccagagacctgatatatgctgaatttctaacgagttttatatatgtgaagaacaatatatga |
123 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14510075 |
tggtcatgttttgcatgcaaattgtcaatatgaagaggccagagacctgatatatgctgaatttctaacgagttttatatatgtgaagaacaatacatga |
14510174 |
T |
 |
| Q |
124 |
tggcatccatgtaaa |
138 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14510175 |
tggcatccatgtaaa |
14510189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 218 - 336
Target Start/End: Original strand, 14510312 - 14510429
Alignment:
| Q |
218 |
gttgatggtcatacatatgacaccttctggaaacatgttatgcattgggattacttaatgacgataaagagtttataaatggaattattaaatcaagtga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14510312 |
gttgatggtcatacatatgacaccttctggaaacatattatgcattgggattacttaat-acgataaagagtttataaatggaattattaaatcaagtga |
14510410 |
T |
 |
| Q |
318 |
tttgggttcgattgaataa |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14510411 |
tttgggttcgattgaataa |
14510429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 328
Target Start/End: Original strand, 5464991 - 5465036
Alignment:
| Q |
283 |
aaagagtttataaatggaattattaaatcaagtgatttgggttcga |
328 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
5464991 |
aaagagtttatagatggaattacaaaatcaagtgatttggattcga |
5465036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 325
Target Start/End: Complemental strand, 17719 - 17611
Alignment:
| Q |
218 |
gttgatggtcatacatatgacaccttctggaaa-catgttatgcattgggattacttaatgacgataaagagtttataaatggaattattaaatcaagtg |
316 |
Q |
| |
|
||||| |||| ||||||| |||||||| |||| ||| |||||| ||| |||||||| |||| | ||||||||||||| || |||||| ||||||| || |
|
|
| T |
17719 |
gttgacggtcctacatattacaccttcccgaaaacatattatgctttgagattacttgatgatggtaaagagtttatatattgaattacaaaatcaaatg |
17620 |
T |
 |
| Q |
317 |
atttgggtt |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
17619 |
ttttgggtt |
17611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University