View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20089_low_5 (Length: 330)
Name: NF20089_low_5
Description: NF20089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20089_low_5 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 116 - 317
Target Start/End: Original strand, 14510659 - 14510860
Alignment:
| Q |
116 |
acgatgatttaaagattttatgtttaatcgatattgaaaagttgcttcaactaaatagacggtcgcttcaaaaattaaaatctaagccacgaccaaacac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14510659 |
acgatgatttaaagattttatgtttaatcgatattgaaaagttgcttcaactaaatagacggtcgcttcaaaaattaaaatctaagccacgaccaaacac |
14510758 |
T |
 |
| Q |
216 |
tgctgcatcggaccttcatgaataannnnnnngttgatgagctaaattatgacagggttgaattgacaaagacacattactggtgtagactaatgaacat |
315 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14510759 |
tgctgcatcggaccttcatgaataatttttttgttgatgagctaaattatgacagggttgaattggcaaagacacattactggtgtagactaatgaacat |
14510858 |
T |
 |
| Q |
316 |
at |
317 |
Q |
| |
|
|| |
|
|
| T |
14510859 |
at |
14510860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 292
Target Start/End: Complemental strand, 17298 - 17254
Alignment:
| Q |
248 |
gttgatgagctaaattatgacagggttgaattgacaaagacacat |
292 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
17298 |
gttgatgagctaagttatgacaaggttgaattggcaaagacacat |
17254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University