View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2008_high_5 (Length: 223)
Name: NF2008_high_5
Description: NF2008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2008_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 4 - 162
Target Start/End: Original strand, 33629643 - 33629796
Alignment:
| Q |
4 |
ataggtccaaataaactggaaataagcttctaaacgcgcacctctatctatgatgctcacaataaaactttcagtcttggatttggatttggcataaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33629643 |
ataggtccaaataaactggaaataagcttctacacgcgcacctctatca-----gctcacaataaaactctcagtcttggatttggatttggcataaatt |
33629737 |
T |
 |
| Q |
104 |
gttttacaccttccaaatatcaatggaaaatggaaggaaaaggatttttcaatgaatgt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33629738 |
gttttacaccttccaaatatcaatggaaaatggaaggaaaaggatctttcaatgaatgt |
33629796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University