View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2008_low_4 (Length: 226)
Name: NF2008_low_4
Description: NF2008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2008_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5342746 - 5342969
Alignment:
| Q |
1 |
cctcaaccgcattaaaacatcttcaccacaggctggtgatctcttcctgaagaccagtggatgattctgttccaagaaccccacttttcagctcaagcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5342746 |
cctcaaccgcattaaaacatcttcaccacaggctggtgatctcttcctgaagaccagtggatgattctgttccaagaaccccacttttcagctcaagcag |
5342845 |
T |
 |
| Q |
101 |
ctccccgcaaaggcctaaagactggttggaaaacacttttgacttttcaagatttgattcatttagcacacacaatagtgtatctttacctgctcgggaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
5342846 |
ctccccgcaaaggcctaaagactggttggaaaacacttttgacttttcaagatttgattcatttagcacacacgatagcgtatctttacctgctcgggaa |
5342945 |
T |
 |
| Q |
201 |
gcacaaccaccagtaagatttgat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5342946 |
gcacaaccaccagtaagatttgat |
5342969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43480016 - 43480250
Alignment:
| Q |
1 |
cctcaaccgcattaaaacatcttcaccacaggctggtgatctcttcctgaagaccagtggat-----------gattctgttccaagaaccccacttttc |
89 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
43480016 |
cctcaaccccattaaaacatcctcaccacaggctgctgatctcttccagaagaccagtggattcagttttgatgattctgttccaagcaccccacttttc |
43480115 |
T |
 |
| Q |
90 |
agctcaagcagctccccgcaaaggcctaaagactggttggaaaacacttttgacttttcaagatttgattcatttagcacacacaatagtgtatctttac |
189 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43480116 |
agctcaagcagttccccacaaaggcctaaagactggttggaaaacgcttttgacttttcaagatttgattcatttagcacacacgatagtgtatctttac |
43480215 |
T |
 |
| Q |
190 |
ctgctcgggaagcacaaccaccagtaagatttgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
43480216 |
ctgctcgggaagcacaaccaccagtacgatttgat |
43480250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University