View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_high_33 (Length: 323)
Name: NF20090_high_33
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 79 - 309
Target Start/End: Complemental strand, 11296143 - 11295914
Alignment:
| Q |
79 |
tgttcctttttctacttcatttacatacatctctagtttcctggcaacaaattaacctggatatttttgtgtcatttttccttcactatgatattattat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11296143 |
tgttcctttttctacttcatttacatacatctctagtttcctggcaacaaattaacctggatatttttgtgtcatttttccttcactatg-tattattat |
11296045 |
T |
 |
| Q |
179 |
atattcattttctcaaaattttggctttgcaaaattaactagcaaaatagaataggattgcaaaattgaacacaaaaactgtggctttcaaatgggaaga |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
11296044 |
atattcattttctcaaaattttggctttgcaaaattaactagcaaaatagaataggattgcaaaattgaacacaaaaactgtggcttacaaatgggtaga |
11295945 |
T |
 |
| Q |
279 |
ccaagcacttgcagactatatcatattcatg |
309 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
11295944 |
ccaagtacttgcagactatatcatattcatg |
11295914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University