View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_high_46 (Length: 269)
Name: NF20090_high_46
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 18677553 - 18677467
Alignment:
| Q |
14 |
agatgaatgtgtttgtatttaacacgttctaataattctcatgaagctggcaaggtaacacaataaaataaataagcaccggcgtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18677553 |
agatgaatgtgtttgtatttaacacgttctaataattctcatgaagctggcaaggtaacacaataaaataaataagcaccggcgtgc |
18677467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University