View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_high_48 (Length: 262)
Name: NF20090_high_48
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 118 - 252
Target Start/End: Original strand, 5770682 - 5770816
Alignment:
| Q |
118 |
gacgattaaacaccgatcaggttttgtccacgattgaaatttcttttatggctaatcataagagtagtgatatattgtacattattgcatcctctaattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5770682 |
gacgattaaacaccgatcaggttttgtccacggttgaaatttcttttatggctaatcataagagtagtgatatattgtacattattgcatcctctaattt |
5770781 |
T |
 |
| Q |
218 |
ggactatccagatctgtaaaaatttccttcctttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5770782 |
ggactatccagatctgtaaaaatttccttcctttg |
5770816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 5770581 - 5770615
Alignment:
| Q |
18 |
aattgggaggatgactgttttggaatattggatga |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5770581 |
aattgggaggatgactgttttggaatattggatga |
5770615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University