View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_high_49 (Length: 261)
Name: NF20090_high_49
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 32266399 - 32266629
Alignment:
| Q |
1 |
tgaatctacaaatttgattttctttgaaccatatctgaaatccctcgaatctgaattattcgaaacaccaccaatcccaaccattttcagcttctttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32266399 |
tgaatctacaaatttgattttctttgaaccatatctgaaatccctcaaatctgaattattcgaaacacc---aatcccaaccattttcagcttctttttc |
32266495 |
T |
 |
| Q |
101 |
ttctccgcaacaaattcacgagcattattagctacaaatttgttaccatttctgataacaatcttcgatttcgtctctaaaacaatctcattgttattat |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
32266496 |
ttctccgcaacaaattcacgagcatgattagctacaaatttgttaccatttctgataacaatcttggatttcgtctctagaacaatctcattgttattat |
32266595 |
T |
 |
| Q |
201 |
cagaagattcagaaacaaaacgacccttatgacc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32266596 |
cagaagattcagaaacaaaacgacccttatgacc |
32266629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University