View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_high_63 (Length: 215)
Name: NF20090_high_63
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_high_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 6032565 - 6032386
Alignment:
| Q |
20 |
atgaattaatcctaggtcttaaagtacgatttgtctaatatcatggtttcatgcagactttcaatgaagttcagagattgctgagtaagaccaacgggaa |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6032565 |
atgaattaatcctatgtcttaaagtacgatttgtctaatatcatggtttcatgcagactttcaatgaagttcagagattgctgagtaagaccaatgggaa |
6032466 |
T |
|
| Q |
120 |
ggtgatcggtgaattaatgactactgcccctatggttgttcgcgagaccaccaatcttgaggatgctgctaggttcttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032465 |
ggtgatcggtgaattaatgactactgcccctatggttgttcgcgagaccaccaatcttgaggatgctgctaggttcttct |
6032386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University