View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_19 (Length: 367)
Name: NF20090_low_19
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 196 - 352
Target Start/End: Original strand, 46767517 - 46767673
Alignment:
| Q |
196 |
cagttggattcaaatcgattgaaaacatgttttgacccttacttagagtaatcattgataacattttatttaagtgaacttaaatcattatggttatttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46767517 |
cagttggattcaaatcgattgaaaacatgttttgacccttacttagagtaatcattgataacattttatttaagtgaacttaaatcattatggttatttc |
46767616 |
T |
 |
| Q |
296 |
atgttcccattgatacaacctagcggttttgcagtgagggtcttctatgtagaatat |
352 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
46767617 |
atgttcccattggtacaacctagcggttttgctgtgagggtcttttatgtaggatat |
46767673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 34 - 142
Target Start/End: Original strand, 46767208 - 46767316
Alignment:
| Q |
34 |
agggatggtacaaagcaaactttattattgctttatagaataatgttatcgaatattagcaacactcnnnnnnncaacattctagattgtgagacttata |
133 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46767208 |
agggatggtacaaagcaaacgttattattgctttatagaataatgttatcgaatattagcaacactcttttttttaacattctagattgtgagacttata |
46767307 |
T |
 |
| Q |
134 |
ttgatttca |
142 |
Q |
| |
|
||||||||| |
|
|
| T |
46767308 |
ttgatttca |
46767316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University