View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_29 (Length: 336)
Name: NF20090_low_29
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_29 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold1543 (1 HSPs) |
 |  |  |
|
| [»] scaffold0421 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 6e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 21625750 - 21625673
Alignment:
| Q |
24 |
tggattagtgtgtggaactagaattatagttatacaaattctttaactaagctatgtctaggaacattaagtaattaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21625750 |
tggattagtgtgtggaactagaattatagttatacaaattctttaactaagctatgtttaggaacattaagtaattaa |
21625673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 95 - 174
Target Start/End: Complemental strand, 21625471 - 21625392
Alignment:
| Q |
95 |
taattaagtcatagacttcttgtgatacttaagaactaggccagtttatagacagagcaaaagaaaagtattttctttac |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21625471 |
taattaagtcatagacttcttgtgatacttaagaactaggccaatttatagacagagaaaaagaaaagtattttctttac |
21625392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 47345551 - 47345492
Alignment:
| Q |
184 |
ttcatgtaccactcttttggtacacccttttctaccaccaatgacatggcatggaaatat |
243 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
47345551 |
ttcatgtattactcttttggtacacccttttatagcactgatgacatgacatggaaatat |
47345492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 336493 - 336571
Alignment:
| Q |
23 |
atggattagtgtgtggaactagaattatagttatacaaattctttaactaagctatgtctaggaacattaagtaattaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
336493 |
atggattagtgtgtggaactagaattatagttatacaaattctttaactaagttatgcctaggaatattaagtaattaa |
336571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1543 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: scaffold1543
Description:
Target: scaffold1543; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 95 - 174
Target Start/End: Complemental strand, 1637 - 1558
Alignment:
| Q |
95 |
taattaagtcatagacttcttgtgatacttaagaactaggccagtttatagacagagcaaaagaaaagtattttctttac |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1637 |
taattaagtcatagacttattgtgatacttaagaaataggtcagtttatagacagagaaaaagaaaagtattttctttac |
1558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0421 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 13270 - 13336
Alignment:
| Q |
177 |
aaaaagattcatgtaccactcttttggtacacccttttctaccaccaatgacatggcatggaaatat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13270 |
aaaaagattcatgtaccactcttttggtacacccttttctaccaccgatgacatggcatggaaatat |
13336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University