View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_38 (Length: 306)
Name: NF20090_low_38
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 16 - 125
Target Start/End: Complemental strand, 31121316 - 31121207
Alignment:
| Q |
16 |
cagttccctcttgaagcactgccactatcgctaccattcgaatcatcatcatcatccttatttttcttggtctgcaaaattaataaagtacaattaacat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | | |
|
|
| T |
31121316 |
cagttccctcttgaagcactgccactatcgctaccattcgaatcatcatcatcatccttatttttcttggtctgcaaaattaacaaagtacaattagctt |
31121217 |
T |
 |
| Q |
116 |
cagcatcatt |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
31121216 |
cagcatcatt |
31121207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University