View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_40 (Length: 292)
Name: NF20090_low_40
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 81 - 272
Target Start/End: Original strand, 2103047 - 2103238
Alignment:
| Q |
81 |
attgttgaagggttctaactctgcagctgatgctcaagcaaatcgcggcaaaaatcttggaggttagacttcacaagacttttctgagttcttataggtt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2103047 |
attgttgaagggttctaactctgcagctgatgctcaagcaaatcgtggcaaaaatcttggaggttagacttcacaagacttttctgagttcttattggtt |
2103146 |
T |
 |
| Q |
181 |
tcaattctttgatttcctggtagatgaaatagcaatgacttacagccaaagttgctttnnnnnnncttctttcacttgtgtttggttgcaat |
272 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
2103147 |
tcaattctttgatttcctagtagatgaaatagcaatgacttacagccaaagttgctttaaaaaaacatctttcacttgtgtttggttgcaat |
2103238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 2102995 - 2103039
Alignment:
| Q |
13 |
tactcttgaataaaagatctgatatctgattttgacaaacccatg |
57 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
2102995 |
tactcttgaataaaagatctgatttgtgattttgacaaacccatg |
2103039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 81 - 272
Target Start/End: Complemental strand, 39182592 - 39182404
Alignment:
| Q |
81 |
attgttgaagggttctaactctgcagctgatgctcaagcaaatcgcggcaaaaatcttggaggttagacttcacaagacttttctgagttcttataggtt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39182592 |
attgttgaagggttctaactctgcagctgatgctcaagcaaatcgcggcaaaaatcttggaggttagacttcacaagacttt--tgagttcttataggtt |
39182495 |
T |
 |
| Q |
181 |
tcaattctttgatttcctggtagatgaaatagcaatgacttacagccaaagttgctttnnnnnnncttctttcacttgtgtttggttgcaat |
272 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||||||||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
39182494 |
tcaattctttgattttctagtagatgaaatagcaa-gacttacagccaaagctgctttaaacaaacatctttcacttgtgtttggttgcaat |
39182404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University