View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20090_low_48 (Length: 262)

Name: NF20090_low_48
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20090_low_48
NF20090_low_48
[»] chr4 (2 HSPs)
chr4 (118-252)||(5770682-5770816)
chr4 (18-52)||(5770581-5770615)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 118 - 252
Target Start/End: Original strand, 5770682 - 5770816
Alignment:
118 gacgattaaacaccgatcaggttttgtccacgattgaaatttcttttatggctaatcataagagtagtgatatattgtacattattgcatcctctaattt 217  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5770682 gacgattaaacaccgatcaggttttgtccacggttgaaatttcttttatggctaatcataagagtagtgatatattgtacattattgcatcctctaattt 5770781  T
218 ggactatccagatctgtaaaaatttccttcctttg 252  Q
    |||||||||||||||||||||||||||||||||||    
5770782 ggactatccagatctgtaaaaatttccttcctttg 5770816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 5770581 - 5770615
Alignment:
18 aattgggaggatgactgttttggaatattggatga 52  Q
    |||||||||||||||||||||||||||||||||||    
5770581 aattgggaggatgactgttttggaatattggatga 5770615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University