View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_50 (Length: 257)
Name: NF20090_low_50
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 125 - 238
Target Start/End: Complemental strand, 53035524 - 53035404
Alignment:
| Q |
125 |
ttttcttttgaaataaaataataattataatt-------atttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53035524 |
ttttcttttgaaataaaataataattattagttttggaaatttccaaacgctgaattacaggattgttggttggtgtcgcggcggcgggtaagagagtgt |
53035425 |
T |
|
| Q |
218 |
gggtttagggttttagcgatg |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53035424 |
gggtttagggttttagcgatg |
53035404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University