View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_51 (Length: 253)
Name: NF20090_low_51
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_51 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 13 - 178
Target Start/End: Complemental strand, 33033191 - 33033027
Alignment:
| Q |
13 |
caaaggtgaaacttatccagggaggtatttggcctaaaaataaacattgaatttgaacaagctaagatcactaaagactagatatctactagactttcat |
112 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33033191 |
caaacgtgaaacttacccagggaggtatttggcctaaaaataaacattgaatttgaacaagctaagatcactaaagactagatatctattagtctttc-- |
33033094 |
T |
|
| Q |
113 |
agtgtcaaacaatggtgtttgtttt-aaattactgctagtagatcatggagcaaatagatgagtcca |
178 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33033093 |
agtgtcaaataatggtgtttgttttaaaattactgctagtagatcatggagcaaatggatgagtcca |
33033027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 213 - 253
Target Start/End: Complemental strand, 33032955 - 33032915
Alignment:
| Q |
213 |
atgaaaatgaaaatgaaatggctcagaaaaataatgggtat |
253 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032955 |
atgataatgaaaatgaaatggctcagaaaaataatgggtat |
33032915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University