View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20090_low_58 (Length: 233)
Name: NF20090_low_58
Description: NF20090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20090_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 41518571 - 41518772
Alignment:
| Q |
17 |
aaagggttcatgtccaaattgtggagaagaggttagtcattgccccctcaaacttttgtagtctttcatagtttccttaacttctttggctgttacccat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41518571 |
aaagggttcatgtccaaattgtggagaagaggttagtcattgccccctcaaacttttgtagtctttcatagtttccttaacttctttggctgttacccat |
41518670 |
T |
 |
| Q |
117 |
gtcatagtaaaccattgttggccgtctttgactaacgatcttgtttggatacacatcttaaccgaacacttattcgataagcaattatcttattatgagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41518671 |
gtcatagtaaaccattgttggccgtctttgactaacgatcttgtttggatacacatcttaaccgaacacttattcgataagcaattatcttattatgagc |
41518770 |
T |
 |
| Q |
217 |
tt |
218 |
Q |
| |
|
|| |
|
|
| T |
41518771 |
tt |
41518772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 23888738 - 23888766
Alignment:
| Q |
25 |
catgtccaaattgtggagaagaggttagt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23888738 |
catgtccaaattgtggagaagaggttagt |
23888766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University