View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_high_23 (Length: 448)
Name: NF20094_high_23
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_high_23 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 440; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 1 - 448
Target Start/End: Complemental strand, 54774594 - 54774147
Alignment:
| Q |
1 |
tttgcttgccattgtctctgttgcaaatgctcttgtgacgatgtatgctaaatgtggtagccttgatgatgcggttcggacttttgagttttcgggggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774594 |
tttgcttgccattgtctctgttgcaaatgctcttgtcacgatgtatgctaaatgtggtagccttgatgatgcggttcggacttttgagttttcgggggat |
54774495 |
T |
|
| Q |
101 |
aagaattcgattacttggtcagccatggttacgggctatgcgcagggtggggactcggataaagctttgaagctgtttaataaaatgcattcttctggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774494 |
aagaattcgattacttggtcagccatggttacgggctatgcgcagggtggggactcggataaagctttgaagctgtttaataaaatgcattcttctggag |
54774395 |
T |
|
| Q |
201 |
tgctgccttctgagtttactttagttggggtgatcaatgcttgcagtgacctttgtgctgttgtagaagggaaacagatgcatagttttgccttcaagtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774394 |
tgctgccttctgagtttactttagttggggtgatcaatgcttgcagtgacctttgtgctgttgtagaagggaaacagatgcatagttttgccttcaagtt |
54774295 |
T |
|
| Q |
301 |
ggggtttggattgcaattgtatgttttgtcagctgtggtggatatgtatgcaaaatgtggtagcttagcggatgctcgtaagggttttgagtgtgtacag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774294 |
ggggtttggattgcaattgtatgttttgtcagctgtggtggatatgtatgcaaaatgtggtagcttagcggatgctcgtaagggttttgagtgtgtacag |
54774195 |
T |
|
| Q |
401 |
caacctgatgttgtgctttggacttctatcataacagggtatgtacag |
448 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54774194 |
caacctgatgttgttctttggacttctatcataacagggtatgtacag |
54774147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University