View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_high_54 (Length: 297)
Name: NF20094_high_54
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 13315604 - 13315812
Alignment:
| Q |
1 |
tgtccaaaagaaataaaaaggtgtaatttagccaccagtcgtttcaagagaggacccaaagattgggtgcagtatgctgccaattttattttcatcttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13315604 |
tgtccaaaagaaataaaaaggtgtaatttagccacttgtcgtttctagagaggacccaaagattgggtgcagtatgctgccaattttattttcttcttct |
13315703 |
T |
 |
| Q |
101 |
gannnnnnngtaaggtatggcgtgaatggaacattgttgttcttcccttgagtcaaatattcctcaacaagaccaaccatgtactgaactgggacacacc |
200 |
Q |
| |
|
|| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||| ||| |||| |
|
|
| T |
13315704 |
gattttttt-taa-------cgtgaatggaacgttgttgttcttcccttgagtcaaatattcctcaacaagatcgtccatgtattgaactgcgacgcacc |
13315795 |
T |
 |
| Q |
201 |
tatatatgaggaggcactatt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13315796 |
----tatgaggaggcactatt |
13315812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 280
Target Start/End: Original strand, 13316006 - 13316057
Alignment:
| Q |
229 |
taatagcatcatcagtaacaacagttgcatcccgaggtatgacaattgcagg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13316006 |
taatagcatcatcagtaacaacagttgcatcccaaggtatgacaattgcagg |
13316057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 229 - 278
Target Start/End: Complemental strand, 13308534 - 13308485
Alignment:
| Q |
229 |
taatagcatcatcagtaacaacagttgcatcccgaggtatgacaattgca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13308534 |
taatagcatcatcagtaacaacagttgcatcccgtggtatgacatttgca |
13308485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University