View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_high_76 (Length: 250)
Name: NF20094_high_76
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_high_76 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 15850944 - 15851188
Alignment:
| Q |
13 |
aatatgatcttgtagaatttttatgcttcttatgcttataagtcttaggagggtgcatacatggaagtgaaattgacaatcatgtatcctagcnnnnnnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15850944 |
aatatgatcttgtagaatttttatgcttcttatgcttataagtcttaggagggtgcatacatggaagtgaaattgacaatcatgtatcctagc--ttttt |
15851041 |
T |
 |
| Q |
113 |
nnnnnnnnnacgttgtatcctagctttaaattgaactatttacttcac---------tttattttcaggttatggtttttatgtggtgcatttatagaaa |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15851042 |
tttttttttacgttgtatcctaactttaaattgaactatttacttcactttttttttttttttttcaggttatggtttttatgtggtgcatttatagaaa |
15851141 |
T |
 |
| Q |
204 |
ggaagaggaaatgcagtcacatcaataacaccagtgcaatattgcac |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15851142 |
ggaagaggagatgcagtcacatcaataacaccagtgcaatattgcac |
15851188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 182
Target Start/End: Original strand, 31997426 - 31997478
Alignment:
| Q |
130 |
tcctagctttaaattgaactatttacttcactttattttcaggttatggtttt |
182 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||| |||||||| |||| |
|
|
| T |
31997426 |
tcctagctttaaattgaactgtttatttcacttagtttttaggttatgttttt |
31997478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University