View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_high_92 (Length: 227)
Name: NF20094_high_92
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_high_92 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 46773378 - 46773588
Alignment:
| Q |
1 |
tacacaaacttataaaattatctccttttgtggtaannnnnnnnnatggaatctccttttgcggtaatagtgatgttatttgaacacaattttgacatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46773378 |
tacacaaacttataaaattatctccttttgtggtaatgtttttttatggaatctccttttgcggtaatagtgatgttatttgaacacaattttgacatga |
46773477 |
T |
|
| Q |
101 |
acactatataaagtatatttttgctaaatcgacataaatttaggaattagctgaaaacgaggctatattgctaacgcgtaagcggtcacatttgcatgtt |
200 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46773478 |
acactatataaagtatattttggttaaatcgacataaatttaggagttagttgaaaacgaggctatattgctaacgcgtaagcggccacatttgcatgtt |
46773577 |
T |
|
| Q |
201 |
atgaataaatt |
211 |
Q |
| |
|
|||||||||| |
|
|
| T |
46773578 |
ctgaataaatt |
46773588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University