View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_high_95 (Length: 225)
Name: NF20094_high_95
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_high_95 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 5982968 - 5982782
Alignment:
| Q |
20 |
atagtctgaaaagtaaaccatagtaagttcttgtagccaacaactttgacatacttcatctacatagtatagcgataattgtcagcataactgttgtagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982968 |
atagtctgaaaagtaaaccatagtaagttcttgtagccaacaactttgacatacttcatctacatagtatagcgataattgtcagcataactgttgtagt |
5982869 |
T |
|
| Q |
120 |
ggatcatgggattgggtcttgacattggcatccttgaaccataatgtccataatccggtcccatgagatgaccatatccattgtaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982868 |
ggatcatgggattgggtcttgacattggcatccttgaaccataatgtccataatccggtcccatgagatgaccatatccattgtaac |
5982782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University