View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_40 (Length: 345)
Name: NF20094_low_40
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_40 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1099 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 334
Target Start/End: Original strand, 1256 - 1594
Alignment:
| Q |
16 |
atatctcaacattatcagtcattttatcacacatttattgttgttt-aaattttgtaaaatttgacatcaatacctattaatattaattatacttcaact |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256 |
atatctcaacattaacagtcattttatcacacatttattgttgttttaaattttgtaaaatttgacatcaatacctattaatattaattatacttcaact |
1355 |
T |
|
| Q |
115 |
tttgattcattcaaaatcattttttcttaatgagtaacttcgtgtcatattagcatgtgtgtgcgcgcattcgcatgtaaagataaaagacctttgtggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1356 |
tttgattcattcaaaatcattttttcttaatgagtaacttcgtgtcatattagcatgtgtgtgcgcgcatgcgcatgtaaagataaaagacctttgtggt |
1455 |
T |
|
| Q |
215 |
ccgtaaacgtttggtgcacttcacaa-----------------actgattaaaaagattaagtagcttttcataatattatcatataaaatattttagt- |
296 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1456 |
ccgtaaacgttcggtgcacttcacaaagtacggaattttagccactgattaaaaagattaagtagcttttcataatattatcatataaaatattttagtt |
1555 |
T |
|
| Q |
297 |
-tataattcaacaattaccttttaaattgccccattcat |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1556 |
atataattcaacaattaccttttaaattgccccattcat |
1594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University