View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_50 (Length: 321)
Name: NF20094_low_50
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 61526 - 61218
Alignment:
| Q |
1 |
aatgaatgaaattagaaagagaaatgattggtgtgtagagaaagaatgaatgggtgatagataaaacttatactgtccgtaaatttcgatatccaaaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
61526 |
aatgaatgaaattagaaagagaaatgattggtgtgtagagaaagaatgaatgggtgatagataaaacttattctgtccgtaaatttcgatatccaaaggt |
61427 |
T |
 |
| Q |
101 |
cccaatttgttgtcatggttgttataaacatttcatttgaattagttatcttcatttcgtcttctctgtccgtattctctattctcccaacccaatctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
61426 |
cccaatttgttgtcatggttgttataaacatttcatttgaattagttatcttcatttcgtcttctctctccgtattctctattctcccaacccaatctat |
61327 |
T |
 |
| Q |
201 |
gtacgtgtatgcatgtattgtattgtaactgcatctc--tcgcacagacacttttgatcgaatgatcctgcccagacatattt-ctttttaatttgttat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
61326 |
gtacgtgtatgcatgtattgtattgtaactgcatctctgtagcacagacacttttgatcgaatgatcctacccagacatatttcctttttaatttgttat |
61227 |
T |
 |
| Q |
298 |
tgttattat |
306 |
Q |
| |
|
||||||||| |
|
|
| T |
61226 |
tgttattat |
61218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University