View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_51 (Length: 321)
Name: NF20094_low_51
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 11299958 - 11300136
Alignment:
| Q |
23 |
aaaaggatattacgaacgaagtat--gtatggtgacatcaataacgaataatgatgctgaatggatgataaaatatcctatatttatcgagagaaaaaag |
120 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11299958 |
aaaaggatattgcgaacgaagtatatgtatggtgacatcaataacgaataatgatgctgaatggatgataaaatatcctatatttatcgagaaaaaaaag |
11300057 |
T |
|
| Q |
121 |
atataaatgaaagacgaagtttatgatgatgctgaagatttggttatttagaggataatatatgaaagagagtaataaa |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11300058 |
ctataaatgaaagacgaaggttatgatgatgctgaaggtttggttatttagaggataatatataaaagagagtaataaa |
11300136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University