View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_53 (Length: 306)
Name: NF20094_low_53
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 10 - 155
Target Start/End: Original strand, 929296 - 929439
Alignment:
| Q |
10 |
gagagaataatatagaaattcgttgtttttatnnnnnnnnncccgagaatgctaggcacataagctttcaacaattatttttctttgtaaattgttttgt |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929296 |
gagagaataatatagaacttcgttgtttttataaaaaaa--cacgagaatgctaggcacataagctttcaacaattatttttctttgtaaattgttttgt |
929393 |
T |
 |
| Q |
110 |
cttgcgtgtatgttgctttgaagtggtagaactaccattaaacaag |
155 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
929394 |
cttgcgtgtatgttgctttgaagcggtagaactatcatcaaacaag |
929439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 50955827 - 50955878
Alignment:
| Q |
101 |
ttgttttgtcttgcgtgtatgttgctttgaagtggtagaactaccattaaacaag |
155 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| ||| ||||||| |
|
|
| T |
50955827 |
ttgtgttgtcttgcgtgtatgtt---ttgaagtggtagaactatcatcaaacaag |
50955878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University