View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_54 (Length: 302)
Name: NF20094_low_54
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_54 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 16 - 302
Target Start/End: Complemental strand, 47019332 - 47019049
Alignment:
| Q |
16 |
gaaacttcactcgacatcttatccaaagcctctagaatgccttgatgaatgagaaacactttcattttgagatgccacaaaccaaaattgttttttctgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47019332 |
gaaacttcactcgacatcttatccaaagcctctagaatgccttgatgaatgagaaacactttcattttgagatgccacaaaccaaaattgttttttctgt |
47019233 |
T |
 |
| Q |
116 |
tcaaaatcaaactttattgatgttggatcatgatttacaacagaaactattttgaactttaacaaaaataatagatgccaatgcaagtcgattgattgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47019232 |
tcaaaatcaaactttattgatgttggatcatgatttacaacagaaactatgttgaactttaacaaa---aatagatgccaatgcaagtcgattgattgaa |
47019136 |
T |
 |
| Q |
216 |
aatcaactgagtgcataaaagcaagaaataggaatcataaattgtaaaaacataaacgaaattaggttacccagttttgagatgaac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47019135 |
aatcaactgagtgcataaaagcaagaaataggaatcataaattgtaaaaacataaacgaaattaggttacccagttttgagatgaac |
47019049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University