View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_59 (Length: 287)
Name: NF20094_low_59
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 273
Target Start/End: Complemental strand, 40002589 - 40002337
Alignment:
| Q |
21 |
ttctagggtggagacatagaggatcgtcacccacatgccatgatgtttattttcttgaagggtcaagttgtcacagatctattgtcatggagctgtataa |
120 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40002589 |
ttctagggtggagacatagaggatcgtgacccacatgccatgatgtttattttcttgaagggccaggttgtcacagatctattgtcatggagctgtataa |
40002490 |
T |
|
| Q |
121 |
gcagcaccgcaacacaagttcgtttgagcgaatcagtctttactttggatggctaaactatggacctcgcatggtttgatatcttctgaagtgcatgcta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40002489 |
gcagcaccgcaacacaagttcgtttgagcgaatcagtctttactttggatggctaaactatggacctcgcatggtctgatatcttctgaagtgcatgcta |
40002390 |
T |
|
| Q |
221 |
tgttaatttggatatttgtagaaaattccaagccatccacatgactctgcttc |
273 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
40002389 |
tgtcaatttggatatttgcagaaaattccaagccatccacatgactttgcttc |
40002337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 40002627 - 40002599
Alignment:
| Q |
19 |
atttctagggtggagacatagaggatcgt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40002627 |
atttctagggtggagacatagaggatcgt |
40002599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 204
Target Start/End: Complemental strand, 26236280 - 26236222
Alignment:
| Q |
146 |
gagcgaatcagtctttactttggatggctaaactatggacctcgcatggtttgatatct |
204 |
Q |
| |
|
|||||||| |||||||||| | ||||||| || |||||||||||||| || |||||||| |
|
|
| T |
26236280 |
gagcgaattagtctttactctagatggctcaaatatggacctcgcattgtctgatatct |
26236222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University