View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_64 (Length: 272)
Name: NF20094_low_64
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 35037575 - 35037481
Alignment:
| Q |
10 |
ttgtggtcacaggtgagtaatccctcttgtctcaaatataaataatgattttcttttagatttgttgaacaagttatgtatttgatttatcacata |
105 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35037575 |
ttgtggtcataggtgagtagtccctcttgactcaaatataa-taatgattttcttttagatttgtggaacaagttatgtatttgatttatcacata |
35037481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 198
Target Start/End: Complemental strand, 35037422 - 35037380
Alignment:
| Q |
156 |
gaatatttgtttatatttgaaactggagaagtgtcaattactt |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
35037422 |
gaatatttgtttatatttgaaacttgagaagtatcaattactt |
35037380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 256
Target Start/End: Complemental strand, 35037378 - 35037342
Alignment:
| Q |
220 |
tcttaattttggttttttaccacatctactcaatctt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35037378 |
tcttaattttggttttttaccacatctattcaatctt |
35037342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University