View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20094_low_75 (Length: 254)

Name: NF20094_low_75
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20094_low_75
NF20094_low_75
[»] chr2 (3 HSPs)
chr2 (153-237)||(4702939-4703023)
chr2 (26-106)||(4703071-4703151)
chr2 (153-224)||(4707003-4707074)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 153 - 237
Target Start/End: Complemental strand, 4703023 - 4702939
Alignment:
Q  153 tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaaggagacgatgttca 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4703023 tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaaggagacgatgttca 4702939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 106
Target Start/End: Complemental strand, 4703151 - 4703071
Alignment:
Q  26 gttatgcaaatccttaaccataaaacagtttagtcaatagatcaaacaataaaatctcaagttttagataactaaatccat 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4703151 gttatgcaaatccttaaccataaaacagtttagtcaatagatcaaacaataaaatctcaagttttagataactaaatccat 4703071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 4707074 - 4707003
Alignment:
Q  153 tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaag 224  Q
    |||||||||||||||||||||| ||||||||| ||||||||||| ||| |||| ||||||||| ||||||||    
T  4707074 tatgaccccaacaagttaccatatttgatcttggtgtttatgatctctcggcacgatccatacacctttaag 4707003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University