View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_75 (Length: 254)
Name: NF20094_low_75
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 153 - 237
Target Start/End: Complemental strand, 4703023 - 4702939
Alignment:
| Q |
153 |
tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaaggagacgatgttca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4703023 |
tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaaggagacgatgttca |
4702939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 106
Target Start/End: Complemental strand, 4703151 - 4703071
Alignment:
| Q |
26 |
gttatgcaaatccttaaccataaaacagtttagtcaatagatcaaacaataaaatctcaagttttagataactaaatccat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4703151 |
gttatgcaaatccttaaccataaaacagtttagtcaatagatcaaacaataaaatctcaagttttagataactaaatccat |
4703071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 4707074 - 4707003
Alignment:
| Q |
153 |
tatgaccccaacaagttaccatctttgatcttagtgtttatgatatcttggcaggatccatactcctttaag |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||| ||| |||| ||||||||| |||||||| |
|
|
| T |
4707074 |
tatgaccccaacaagttaccatatttgatcttggtgtttatgatctctcggcacgatccatacacctttaag |
4707003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University